COVID19 – Beweise für globalen Betrug – OffGuardian

Quelle: COVID19 – Evidence Of Global Fraud – OffGuardian

COVID 19 und die nachfolgenden Reaktionen der Regierungen scheinen Teil einer internationalen Verschwörung zum Betrug zu sein. Es gibt offenbar keinen Beweis dafür, dass ein Virus namens SARS-CoV-2 eine Krankheit namens COVID 19 verursacht.

Manchmal muss man dem Bauchgefühl folgen. Ich bin kein Experte auf dem Gebiet der Genetik und lasse mich deshalb wie immer gerne eines Besseren belehren. Meine Aufmerksamkeit wurde jedoch auf einige Forschungsarbeiten gelenkt, die von der spanischen medizinischen Zeitschrift „D-Salud-Discovery“ veröffentlicht wurden. Ihr Beirat aus hervorragend qualifizierten Ärzten und Wissenschaftlern verleiht ihrer Forschung zusätzliche Glaubwürdigkeit. Ihre Behauptung ist verblüffend.

Die genetischen Primer und Sonden, die in RT-PCR-Tests zur Identifizierung von SARS-CoV-2 verwendet werden, zielen auf nichts Spezifisches ab. Ich habe die in dieser englischen Übersetzung ihres Berichts beschriebenen Suchtechniken verfolgt und kann die Richtigkeit ihrer Behauptungen über die in den Protokollen der Weltgesundheitsorganisation aufgeführten Nukleotidsequenzen bestätigen. Sie können dasselbe tun.

„D-Salud-Discovery“ behauptet, daß es keine Tests gibt, die SARS-CoV-2 identifizieren können. Folglich sind alle Behauptungen über die angeblichen Auswirkungen von COVID 19 auf die Gesundheit der Bevölkerung unbegründet.

Die gesamte offizielle Darstellung von COVID 19 ist eine Täuschung. Anscheinend gibt es keine wissenschaftliche Grundlage für irgendeinen Teil davon.

Sollten diese Behauptungen zutreffen, können wir feststellen, dass es keinen Beweis für eine Pandemie gibt, sondern nur die Illusion einer Pandemie. Wir haben ohne ersichtlichen Grund unkalkulierbare Verluste erlitten, abgesehen von den Ambitionen skrupelloser Despoten, die die Weltwirtschaft und unsere Gesellschaft ihren Zwecken entsprechend umgestalten wollen.

Dabei hat diese „Parasitenklasse“ potenziell unzählige Verbrechen begangen. Diese Verbrechen können und sollten vor einem Gericht untersucht und verfolgt werden.

Identifizierung von was genau?

Die Weltgesundheitsorganisation (WHO) klassifizierte COVID-19 (COronaVIrus Disease 2019). Sie erklärte am 11. März 2019 eine globale COVID-19-Pandemie.

In den Leitlinien für Labortests der WHO heißt es:

„Der ätiologische Erreger [Verursacher der Krankheit], der für die Häufung von Lungenentzündungsfällen in Wuhan verantwortlich ist, wurde als ein neuartiges Betacoronavirus identifiziert (in derselben Familie wie SARS-CoV und MERS-CoV), und zwar mittels Next Generation Sequencing (NGS) aus Viruskulturen oder direkt aus Proben, die von mehreren Lungenentzündungspatienten erhalten wurden“.

Die WHO behauptet, dass das SARS-CoV-2-Virus die Krankheit COVID-19 verursacht. Sie behauptet auch, dieses Virus sei von Forschern in Wuhan eindeutig identifiziert worden.

Im „Novel Coronavirus 2019-nCov Situation Report 1“ der WHO wird festgestellt:

„Die chinesischen Behörden identifizierten einen neuen Typ des Coronavirus, der am 7. Januar 2020 isoliert wurde … Am 12. Januar 2020 teilte China die genetische Sequenz des neuartigen Coronavirus mit, damit die Länder sie bei der Entwicklung spezifischer Diagnostik-Kits verwenden konnten.“

Diese beiden Aussagen der WHO deuten eindeutig darauf hin, dass das SARS-CoV-2-Virus isoliert (d.h. für Studienzwecke purifiziert) und dann genetische Sequenzen aus der isolierten Probe identifiziert wurden. Daraus wurden Diagnostik-Kits entwickelt und weltweit verteilt, um das Virus in Städten und Gemeinden auf der ganzen Welt zu testen. Nach Angaben der WHO und chinesischer Forscher werden diese Tests das Virus aufspüren, das COVID 19 verursacht.

Doch erklärt die WHO auch:

„Das Team arbeitete direkt von Sequenzinformationen ausgehend und entwickelte eine Reihe von genetischen Amplifikationstests (PCR), die von Laboratorien verwendet werden.“

Die Wissenschaftler in Wuhan entwickelten ihre genetischen Amplifikationstests aus „Sequenzinformationen“, weil es keine isolierte, gereinigte Probe des so genannten SARS-CoV-2-Virus gab. Sie zeigten auch elektronenmikroskopische Aufnahmen der neu entdeckten Virionen (die stachelige Proteinkugel, die die virale RNA enthält).

Solche Proteinstrukturen sind jedoch nicht einzigartig. Sie sehen genauso aus wie andere runde Vesikel, wie z.B. endocytäre Vesikel und Exosomen.

Virologen behaupten, dass es nicht möglich ist, ein Virus zu „isolieren“, weil es sich nur innerhalb von Wirtszellen vermehrt. Sie fügen hinzu, dass die Postulate von Koch hier nicht zutreffen, weil sie sich auf Bakterien (die lebende Organismen sind) beziehen. Stattdessen beobachten Virologen in Zellkulturen die zytopathogenen Effekte (CPE) des Virus, die Zellmutation und -abbau verursachen.

Als chinesische Forscher erstmals das vollständige SARS-CoV-2-Genom sequenzierten, beobachteten sie CPE in Vero E6- und Huh7-Zellen. Bei Vero E6 handelt es sich um eine immortalisierte Affenzelllinie und bei Huh7 um immortalisierte Krebszellen (tumorerzeugende Zellen). Das bedeutet, dass sie seit vielen Jahren in vitro (in Petrischalenkulturen) erhalten werden.

Im Mittelpunkt der offiziellen SARS-CoV-2-Geschichte steht die Vorstellung, dass es sich um ein zoonotisches Virus handelt, das in der Lage ist, die Spezies Kluft zwischen Tier und Mensch zu überbrücken. Als Wissenschaftler der US-CDC verschiedene Zellen mit dem neuartigen Virus „infizierten“, stellten sie Folgendes fest:

„Wir untersuchten die Fähigkeit von SARS-CoV-2 zur Infektion und Replikation in verschiedenen Zelllinien von Primaten und Menschen, darunter menschliche Adenokarzinomzellen (A549) [Lungenzellen] und menschliche Leberzellen (HUH7.0), und humane embryonale Nierenzellen (HEK-293T), zusätzlich zu Vero E6 und Vero CCL81 [Affenzellen]…Bei keiner der Zelllinien wurde ein zytopathischer Effekt beobachtet, außer bei Vero-Zellen [Affenzellen]…HUH7.0 und 293T-Zellen zeigten nur eine bescheidene virale Replikation und A549-Zellen [Zellen aus menschlichem Lungengewebe] waren mit einer SARS-CoV-2-Infektion inkompatibel.“.

Die CDC hat keinen CPE in menschlichen Zellen beobachtet. Sie sah keinen Beweis dafür, dass dieses angebliche Virus irgendeine menschliche Krankheit verursachte. Auch zeigte dieses angebliche menschliche Virus keine nennenswerte Replikation in menschlichen Zellen, was darauf hindeutet, dass eine Infektion von Mensch zu Mensch unmöglich wäre.

Ein Team polnischer Wissenschaftler bemerkte dieses Problem und brachte dieses sequenzierte „Virus“ in menschliche Epithelzellen (Atemwege) ein. Sie beobachteten 5 Tage lang die Auswirkungen auf diese HAE-Kulturen. Sie beobachteten eine viel größere Replikation als die CDC-Wissenschaftler, stellten aber schlußendlich fest:

„Wir haben keine Freisetzung des Virus von der basolateralen Seite der HAE-Kultur beobachtet.“

Das heißt, sie sahen keine Anzeichen dafür, dass die angeblichen Virionen die Zellwandmembran durchbrachen. Auch dies deutet darauf hin, dass dieses so genannte Virus beim Menschen nicht infektiös ist.

Es ist nicht klar, dass SARS-CoV-2 ein menschliches Virus ist, das Krankheiten verursachen kann. Möglicherweise existiert es nicht einmal physisch. Ist es nichts anderes als ein Konzept, das auf prädizierenden genetischen Sequenzen beruht?

Entdeckungsreise

Das „Wuhan Center for Disease Control and Prevention“ und das „Shanghai Public Health Clinical Centre“ veröffentlichten das erste vollständige SARS-CoV-2-Genom (MN908947.1). Dieses wurde viele Male aktualisiert. MN908947.1 war jedoch die erste genetische Sequenz, die den angeblichen ätiologischen Erreger von COVID 19 (SARS-CoV-2) beschrieb.

Alle nachfolgenden Anträge, Tests, Behandlungen, Statistiken, die Entwicklung von Impfstoffen und die sich daraus ergebenden Richtlinien basieren auf dieser Reihenfolge. Wenn die Tests für dieses neuartige Virus nichts identifizieren, was beim Menschen Krankheiten verursachen könnte, ist die ganze COVID 19-Erzählung nichts als eine Farce.

Die Wuhan-Forscher gaben an, dass sie die genetische Sequenz von SARS-CoV-2 effektiv zusammengesetzt hätten, indem sie die in Proben gefundenen Fragmente mit anderen, zuvor entdeckten genetischen Sequenzen verglichen haben. Anhand des gesammelten Material hätten sie eine 87,1%ige Übereinstimmung mit dem SARS-Coronavirus (SARS-Cov) entdeckt. Sie verwendeten de novo-Assemblierung und gezielte PCR und fanden 29.891 Basenpaare, die eine 79,6%ige Sequenzübereinstimmung mit SARS-CoV aufwiesen.

Sie mussten die de novo-Assemblierung verwenden, da sie keine Vorkenntnisse über die korrekte Reihenfolge dieser Fragmente hatten. Die Aussage der WHO, chinesische Forscher hätten das Virus am 7. Januar isoliert, ist schlicht und einfach falsch.

Das Wuhan-Team verwendete 40 Runden RT-qPCR-Amplifikation, um Fragmente der cDNA (komplementäre DNA, die aus probenbasierten RNA-Fragmenten konstruiert wurde) mit dem veröffentlichten Genom des SARS-Coronavirus (SARS-CoV) abzugleichen. Leider ist auch nicht klar, wie genau das ursprüngliche SARS-CoV-Genom aussieht.

Im Jahr 2003 untersuchte ein Forscherteam aus Hongkong 50 Patienten mit schwerem akuten respiratorischen Syndrom (SARS). Sie entnahmen Proben von 2 dieser Patienten und entwickelten eine Kultur in fetalen Affenleberzellen.

Sie schufen 30 Klone des von ihnen gefundenen genetischen Materials. Da sie keinen Beweis für irgendein anderes bekanntes Virus finden konnten, fanden sie in nur einer dieser geklonten Proben genetische Sequenzen „unbekannter Herkunft“.

Bei der Untersuchung dieser unbekannten RNA-Sequenzen fanden sie 57% Übereinstimmung mit dem bovinen Coronavirus und dem murinen Hepatitis-Virus und schlossen daraus, dass es sich um die Familie Coronaviridae handelte. Unter Berücksichtigung dieser Sequenzen, die auf ein neu entdecktes SARS-CoV-Virus hindeuten (neue Entdeckungen sind für Wissenschaftler Ambrosia), entwarfen sie RT-PCR-Primer, um auf dieses neuartige Virus zu testen. Die Forscher erklärten:

„Primer für den Nachweis des neuen Virus wurden für den RT-PCR-Nachweis dieses menschlichen Pneumonie-assoziierten Coronavirus-Genoms in klinischen Proben entwickelt. Von den 44 verfügbaren nasopharyngealen Proben der 50 SARS-Patienten zeigten 22 das Vorhandensein humaner, mit Lungenentzündung assoziierter Coronavirus-RNA.“

Die Hälfte der getesteten Patienten, die alle die gleichen Symptome hatten, wurde positiv auf dieses neue angebliche Virus getestet. Niemand weiß, warum die andere Hälfte negativ auf dieses neue SARS-CoV-Virus getestet wurde. Die Frage wurde nicht gestellt.

Dieses angebliche Virus hatte nur eine 57%ige Sequenzübereinstimmung mit einem angeblich bekannten Coronavirus. Die anderen 43% waren einfach „da“. Sequenzierte Daten wurden produziert und als neues Genom unter der GenBank-Hinterlegungsnummer AY274119 aufgezeichnet.

Die Forscher in Wuhan fanden daraufhin eine 79,6%ige Sequenzübereinstimmung mit AY274119 und nannten es daher einen neuartigen Stamm von SARS-CoV (2019-nCoV – schließlich in SARS-CoV-2 umbenannt). Niemand hatte zu irgendeinem Zeitpunkt dieses Prozesses eine isolierte, gereinigte Probe irgendeines Virus hergestellt. Alles, was sie hatten, waren prozentuale Sequenzübereinstimmungen mit anderen prozentualen Sequenzübereinstimmungen.

Nichts isoliert

Die Wissenschaftler sind sehr verärgert, weil sie immer wieder sagen, das Virus sei isoliert worden, aber niemand glaube ihnen. Das liegt daran, dass bisher noch keine einzige gereinigte Probe des SARS-CoV-2-Virus zur Verfügung gestellt wurde. Was wir stattdessen haben, ist ein vollständiges Genom, und wie wir gleich feststellen werden, ist es nicht besonders überzeugend.

Die investigativen Journalisten Torsten Engelbrecht und Konstantin Demeter baten einige der Wissenschaftler, die angaben, Bilder von SARS-C0V-2-Viren zu haben, zu bestätigen, dass es sich dabei um Bilder eines isolierten, gereinigten Virus handelt. Keiner von ihnen konnte das bestätigen.

In Australien gaben Wissenschaftler des Doherty-Instituts bekannt, dass sie das SARS-CoV-2-Virus isoliert hätten. Auf die Bitte um Aufklärung sagten die Wissenschaftler:

„Wir haben kurze (RNA-)Sequenzen aus dem diagnostischen Test, die in den diagnostischen Tests verwendet werden können“.

Dies erklärt, warum die australische Regierung verlautbart:

„Die Zuverlässigkeit der COVID-19-Tests ist aufgrund der begrenzten Evidenzbasis unsicher… Es gibt nur begrenzte Evidenz zur Beurteilung der Genauigkeit und des klinischen Nutzens der verfügbaren COVID-19-Tests“.

In Grossbritannien schrieb im Juli eine Gruppe besorgter Akademiker einen Brief an den britischen Premierminister Boris Johnson, in dem sie ihn darum baten:

„Legen Sie bitte unabhängig begutachtete wissenschaftliche Beweise vor, die belegen, dass das Covid-19-Virus isoliert worden ist“.

Bis heute haben sie noch keine Antwort erhalten.

In ähnlicher Weise stellte der britische Forscher Andrew Johnson einen Antrag auf Informationsfreiheit an die „Public Health England“ (PHE). Er bat sie, ihm ihre Aufzeichnungen über die Isolierung eines SARS-COV-2-Virus zur Verfügung zu stellen. Daraufhin antworteten sie:

„PHE kann bestätigen, dass sie keine Informationen in der von Ihnen gewünschten Weise vorliegen hat“.

Die kanadische Forscherin Christine Massey stellte einen ähnlichen Antrag auf Informationsfreiheit und bat die kanadische Regierung um dasselbe. Darauf antwortete die kanadische Regierung:

„Nach Abschluss einer gründlichen Suche bedauern wir, Ihnen mitteilen zu müssen, dass wir keine Unterlagen finden konnten, die Ihrer Anfrage entsprachen.“

In den USA gibt der RT-PCR-Diagnostik-Ausschuß des „Centre for Disease Control“ (CDC) an:

„Derzeit sind keine quantifizierten Virusisolate des 2019-nCoV verfügbar … Der Nachweis von viraler RNA weist möglicherweise nicht auf das Vorhandensein eines infektiösen Virus oder darauf hin, dass 2019-nCoV der Erreger klinischer Symptome ist“.

Zuletzt aktualisiert am 13. Juli 2020, hat die CDC noch keine reine Virusprobe von einem Patienten erhalten, der angeblich an der Krankheit COVID-19 erkrankt ist. Sie geben offen zu, dass ihre Tests nicht unbedingt zeigen, ob SARS-CoV-2 entweder vorhanden ist oder COVID 19 verursacht.

Uns wird gesagt, dass dies alles keine Rolle spiele. Dass wir unwissend sind und die Virologie einfach nicht verstehen. Deshalb müssten wir Bilder von Dingen, von denen wir wissen, dass sie etwas anderes sein könnten, und genetische Sequenzen (die alles andere sein könnten) als schlüssigen Beweis dafür akzeptieren, dass dieses Virus und die Krankheit, die es verursachen soll, real sind.

Testen umsonst

Die WHO und alle Regierungen, Think Tanks, politischen Lenkungsausschüsse, wissenschaftlichen Berater der Regierungen, supranationalen Institutionen und andere, die die offizielle COVID-19-Erzählung fördern, behaupten, dass SARS-CoV-2 COVID 19 verursacht.

Während niemand jemals eine Probe dieses angeblichen Virus hergestellt hat, ist das angebliche SARS-CoV-2-Genom veröffentlicht worden. Es ist der Öffentlichkeit zugänglich.

Den genetischen Schlüsselsequenzen im Genom von SARS-CoV-2 werden spezifische Funktionen zugeschrieben. Dies sind die Zielproteine, auf die Wissenschaftler testen, um das Vorhandensein des „Virus“ zu identifizieren. Dazu gehören:

  • RNA-Polymerase-Gen (Rd-Rp) – Dies ermöglicht es der SARS-CoV-2-RNA, sich im Zytoplasma von COVID 19-kranken Epithelzellen zu replizieren.
  • S-Gen (Orf2) – Dieses Glykoprotein bildet den Spike auf der Oberfläche des SARS-CoV-2-Virus, der angeblich die Bindung von SARS-CoV-2 an die ACE2-Rezeptoren auf den Zellen erleichtert, so dass die RNA innerhalb der Virionproteinhülle (Kapsid) in die nun infizierte Zelle gelangen kann.
  • E-Gen (Orf1ab) – kleines Membranprotein, das beim Zusammenbau des Virus verwendet wird
  • N-Gen (Orf9a) – das Nukleokapsid-Gen, das die RNA bei der Kapsidbildung bindet

Die WHO führt ein öffentlich zugängliches Verzeichnis der RT-PCR-Primer und Sonden, die für den Test auf SARS-CoV-2 verwendet wurden. Bei den Primern handelt es sich um spezifische Nukleotidsequenzen, die sich an die Antisense- und Sense-Stränge der synthetisierten cDNA (Vorwärts- bzw. Rückwärtsprimer genannt) binden (anneal).

Die cDNA-Stränge trennen sich beim Erhitzen und vereinigen sich beim Abkühlen erneut. Vor der Abkühlung werden Nukleotidsequenzen, die als Sonden bezeichnet werden, an spezifische Zielregionen des vermuteten viralen Genoms angeheftet. Während der Amplifikation, wenn sich die Regionen zwischen den Primern verlängern und ein Primer auf eine Sonde trifft, zerfällt die Sonde unter Freisetzung eines Fluoreszenz- oder Farbstoffs, der dann von den Forschern abgelesen werden kann.

Es ist die Identifizierung dieser Marker, von denen die Wissenschaftler behaupten, dass sie damit das Vorhandensein von SARS-CoV-2 in einer Probe beweisen können.

Ebenfalls öffentlich zugänglich ist das „Basic Local Alignment Search Tool“ (BLAST). Damit kann jedermann veröffentlichte Nukleotidsequenzen mit allen in der genetischen Datenbank der „U.S. National Institutes of Health“ (NIH) namens „GenBank“ gespeicherten Sequenzen vergleichen. Daher können wir die beanspruchten SARS-CoV-2-Primer, -Sonden und -Zielgensequenzen BLASTen.

Die Vorwärts-, Rückwärtsprimer und Sondenprotokolle der WHO für das angebliche virale Genom von SARS-CoV-2 basieren auf RdRp-, Orf1-, N- und E-Genprofilen. Jeder kann sie durch BLAST laufen lassen, um zu sehen, was man dabei findet.

Die entscheidende RdRP-Nukleotidsequenz, die als Vorwärtsprimer verwendet wird, ist – ATGAGCTTAGTAGTCCTGTTTG. Wenn wir ein Nukleotid BLAST durchlaufen lassen, wird dies als ein vollständiges SARS-CoV-2-Isolat mit einer 100%igen Sequenzidentität aufgezeichnet. In ähnlicher Weise zeigt die Reverse-E-Gen-Primersequenz – ATATTGCAGCAGCAGTACGCACACACA – das Vorhandensein der Orf1ab-Sequenz, die ebenfalls SARS-CoV-2 identifiziert.

Mit BLAST können wir aber auch die Nukleotidsequenzen des mikrobiellen und menschlichen Genoms durchsuchen. Wenn wir nach der RdRp SARS-CoV-2-Sequenz suchen, finden wir 99 menschliche Chromosomen mit einer 100%igen Sequenzidentität. Das Orf1ab (E-Gen) liefert 90 mit einer 100%igen Sequenzidentität mit menschlichen Chromosomen.

Wenn man dasselbe für diese Sequenzen mit einer mikrobiellen Suche macht, findet man 92 Mikroben mit einer 100%igen Übereinstimmung mit dem SARS-CoV-2-E-Gen und 100 übereinstimmende Mikroben mit einer 100%igen Sequenzidentität mit dem vitalen SARS-CoV-2-RdRp-Gen.

Immer wenn wir die so genannten einzigartigen genetischen Marker für SARS-CoV-2 überprüfen, die in den WHO-Protokollen festgehalten sind, finden wir vollständige oder hochprozentige Übereinstimmungen mit verschiedenen Fragmenten des menschlichen Genoms. Dies deutet darauf hin, dass die genetischen Sequenzen, die SARS-CoV-2 identifizieren sollen, nicht eindeutig sind. Sie könnten alles sein, von mikrobiellen Sequenzen bis hin zu Fragmenten menschlicher Chromosomen.

Sogenannte Faktenprüfer, wie das Health-Feedback-Projekt von Reuters, haben die Behauptungen derjenigen, die den offensichtlichen Mangel an Spezifizität im vermeintlichen SARS-CoV-2-Genom bemerkt haben, schnell zurückgewiesen.

Mit einer Reihe von Strohmann-Argumenten wie „diese Behauptung legt nahe, dass jeder Test positiv sein sollte“ (was sie nicht tut), läuft ihr Entlarvungsversuch in etwa so ab:

„Primer sind so konzipiert, dass sie sich an spezifische Nukleotidsequenzen binden, die für das Virus einzigartig sind. Der Vorwärtsprimer kann an ein bestimmtes Chromosom binden, aber der Rückwärtsprimer bindet nicht an dasselbe Chromosom, so dass das Chromosom im SARS-CoV-2-Virus nicht vorhanden ist. Da der Vorwärts- und der Rückwärtsprimer die zu amplifizierende Sequenz umhüllen, ist die cDMA-Sequenz zwischen den Primern außerdem einzigartig für das Virus.“

Dies scheint die Bedeutung dieser Ergebnisse absichtlich falsch darzustellen, indem ein Argument vorgebracht wird, das niemand außer den Faktenprüfern selbst vorbringt. BLAST-Recherchen zeigen, dass diese Zielsequenzen nicht nur bei SARS-CoV-2 auftreten. Es müssen auch nicht alle Zielsequenzen gefunden werden, damit ein Ergebnis als positiv gewertet werden kann.

Marokkanische Forscher untersuchten die Epidemiologie angeblicher Fälle von SARS-CoV-2 in Marokko. Neun Prozent waren positiv für drei Gene, achtzehn Prozent waren positiv für zwei Gene und dreiundsiebzig Prozent für nur ein Gen. Wie wir gerade diskutiert haben, waren viele möglicherweise für keines positiv.

Dies steht in völliger Übereinstimmung mit den Testleitlinien der WHO. Sie besagen:

„Eine optimale Diagnose besteht aus einem NAAT [Nukleinsäure-Amplifikationstest] mit mindestens zwei genomunabhängigen Zielen des SARS-CoV-2; in Gebieten, in denen die Übertragung weit verbreitet ist, kann jedoch ein einfacher Einzelziel-Algorithmus verwendet werden … Ein oder mehrere negative Ergebnisse schließen eine Infektion mit SARS-CoV-2 nicht unbedingt aus.“

Unabhängig von den fadenscheinigen Argumenten gut finanzierter Faktenprüfer: Wenn die Vorwärts- und Rückwärtsprimer Junk identifizieren, wobei ein Teil vielleicht das Fragment eines Chromosoms und das andere eine mikrobielle Sequenz ist, dann ist die amplifizierte Region zwischen ihnen wahrscheinlich auch Junk.

Das Argument, dass die RT-PCR nur RNA findet, ist fadenscheinig. Die natürliche Transkription (die Trennung der DNA-Stränge) findet während der Genexpression statt. Niemand behauptet, dass ganze Chromosomen oder Mikroben im angeblichen SARS-CoV-2-Genom sequenziert sind. Obwohl sie es nach allem, was wir wissen, sein könnten. Sie sagen, dass die angeblichen Marker, mit denen auf dieses angebliche Virus getestet wird, nicht für den Zweck geeignet sind.

RT-PCR-Tests sequenzieren nicht das gesamte Genom. Sie suchen nach Vorkommnissen von spezifischer Sondenfluoreszenz, um das Vorhandensein angeblicher Sequenzen anzuzeigen. Diese Sequenzen sind in MN908947.1 und den nachfolgenden Aktualisierungen definiert. Diese Primer und Sonden konnten nichts anderes zeigen als RNA-Übereinstimmungen, die aus nicht-kodierender, manchmal als „Junk“-DNA (cDNA) bezeichneter DNA (cDNA) extrahiert wurden.

Zum Beispiel soll das SARS-CoV-2-S-Gen hochspezifisch für das Genom des SARS-CoV-2-Virus sein. Die Zielsequenz ist – TTGGCAAAATTCAAGACTCTCACTTTC. Eine mikrobielle BLAST-Suche liefert 97 mikrobielle Übereinstimmungen mit 100%iger Übereinstimmung der Identitätssequenz. Die niedrigste prozentuale Identitätsübereinstimmung innerhalb der Top 100 beträgt 95%. Ein BLAST des menschlichen Genoms findet auch eine 100%ige Sequenzübereinstimmung mit 86 menschlichen Chromosomenfragmenten.

Egal, wohin man im vermeintlichen Genom von SARS-CoV-2 auch schaut – in den Testprotokollen der WHO gibt es nichts, was es klar identifizieren würde. Das gesamte Genom könnte falsch sein. Die Tests beweisen nicht die Existenz von SARS-CoV-2. Alles, was sie zeigen, ist eine Suppe aus nicht spezifiziertem genetischem Material.

Da es keine Isolate oder gereinigten Proben des Virus gibt, gibt es ohne einen zuverlässigen Test keinen Beweis für die Existenz von SARS-CoV-2. Daher gibt es auch keinen Beweis dafür, dass eine Krankheit namens COVID 19 existiert.

Daraus lässt sich ableiten, dass es keine wissenschaftliche Grundlage für Behauptungen über COVID 19-Fallzahlen, Krankenhauseinweisungen oder Sterblichkeitszahlen gibt. Alle Massnahmen, die zur Bekämpfung dieses tödlichen Virus ergriffen werden, haben möglicherweise keinerlei Grundlage.

Eindeutig Betrug

Betrug ist eine kriminelle Handlung. Die gesetzliche Definition von Betrug ist:

„Irgendeine betrügerische Praxis oder ein vorsätzliches Mittel, das in der Absicht angewandt wurde, einem anderen sein Recht zu entziehen oder ihm in irgendeiner Weise Schaden zuzufügen.“

Die rechtliche Definition einer Verschwörung lautet:

„Eine Kombination oder Konföderation zwischen zwei oder mehreren Personen, die mit dem Ziel gegründet wurde, durch ihre gemeinsamen Bemühungen eine ungesetzliche oder kriminelle Handlung zu begehen“.

Es scheint, dass diejenigen, die behaupten, wir hätten es mit einer Pandemie zu tun, keine Beweise dafür vorgelegt haben, dass ein Virus namens SARS-CoV-2 eine Krankheit namens COVID 19 verursacht. Alle Informationen, die nachdrücklich auf diese Möglichkeit hinweisen, sind in der Öffentlichkeit leicht zugänglich. Jeder kann sie lesen.

Damit ein Betrug vorliegt, muss der Betrug vorsätzlich sein. Die Absicht muss darin bestehen, andere vorsätzlich ihrer Rechte zu berauben oder sie auf andere Weise zu schädigen. Wenn es Beweise für Absprachen zwischen Einzelpersonen und/oder Organisationen gibt, um Betrug zu begehen, dann handelt es sich um eine Verschwörung (in Common-Law-Jurisdiktionen) oder ein „Joint Criminal Enterprise“ (JCE) nach internationalem Recht.

Es scheint, dass COVID 19 absichtlich als Casus Belli benutzt wurde, um Krieg gegen die Menschheit zu führen. Wir wurden in unseren eigenen Häusern inhaftiert, unsere Bewegungsfreiheit eingeschränkt, die Rede- und Meinungsfreiheit ausgehöhlt, das Recht auf Protest beschnitten, von unseren Lieben getrennt, unsere Geschäfte zerstört, wir wurden psychologisch bombardiert, mundtot gemacht und terrorisiert.

Noch schlimmer ist, dass es zwar keine Beweise für eine beispiellose Allursachensterblichkeit gibt, die Todesfälle jedoch unangemessene Spitzenwerte aufwiesen. Diese korrelieren genau mit den Lockdown-Maßnahmen, die den Rückzug der von uns bezahlten Gesundheitsdienste und eine Neuausrichtung der öffentlichen Gesundheitsdienste auf die Behandlung einer angeblichen Krankheit unter Ausschluss aller anderen sahen.

Ferner wird von denjenigen, die das COVID 19-Narrativ gefördert haben, vorgeschlagen, dass diese angebliche Krankheit eine Rechtfertigung für die vollständige Umstrukturierung der globalen Wirtschaft, unserer politischen Systeme, Gesellschaften, Kulturen und der Menschheit selbst darstelle.

Um an ihrer so genannten „Neuen Normalität“ teilhaben zu dürfen, d.h. an der umfassenden Umgestaltung unserer gesamten Gesellschaft ohne unsere Zustimmung, bestehen sie darauf, dass wir uns ihren Bedingungen unterwerfen.

Dazu gehören unter anderem die biometrische Überwachung jedes Einzelnen, die zentralisierte Kontrolle und Überwachung aller unserer Transaktionen, unterdrückerische geschäftliche und soziale Einschränkungen und die effektive Forderung, dass wir kein Recht auf Souveränität über unseren eigenen Körper haben. Dies ist ein Zustand der Sklaverei.

Es besteht kein Zweifel, dass wir unserer Rechte beraubt und geschädigt worden sind. In Common-Law-Jurisdiktionen gilt die Unschuldsvermutung, aber die Beweise dafür, dass der Schaden vorsätzlich durch eine internationale Verschwörung verursacht wurde, sind überwältigend. Destruktive Maßnahmen, die von Regierungen in aller Welt ergriffen wurden, haben ihren Ursprung eindeutig in globalistischen Think Tanks und supranationalen Institutionen, lange vor dem Auftreten dieser nicht existierenden Pandemie.

In den Gerichtsbarkeiten des Napoleonischen Kodex wird Schuld vermutet. Damit die angeklagten Verschwörer ihre Unschuld beweisen können, müssen sie zeigen, dass sie trotz ihrer unermesslichen Ressourcen kollektiv nicht in der Lage waren, Zugang zu den frei verfügbaren Beweisen zu erhalten oder diese zu verstehen, die darauf hindeuten, dass COVID 19 ein Mythos ist.

Diejenigen, die für das Verbrechen der Verschwörung zum weltweiten Betrug verantwortlich sind, sollten vor Gericht gestellt werden. Wenn sie für schuldig befunden werden, sollten sie inhaftiert werden, während der Rest von uns weiter versucht, den Schaden, den sie bereits angerichtet haben, wieder gutzumachen.

Schreibe einen Kommentar